IJPR  articles are Indexed in SCOPUSClick Here     Impact Factor for Five Years is 0.13 (2013 - 2018).    

logo

INTERNATIONAL JOURNAL OF PHARMACEUTICAL RESEARCH

A Step Towards Excellence

IJPR included in UGC-Approved List of Journals - Ref. No. is SL. No. 4812 & J. No. 63703

Published by : Advanced Scientific Research
ISSN
0975-2366
Current Issue
Article In Press
No Data found.
ADOBE READER

(Require Adobe Acrobat Reader to open, If you don't have Adobe Acrobat Reader)

Index Page 1
Click here to Download
IJPR 9[3] July - September 2017 Special Issue

July - September 9[3] 2017

Click to download
 

Article Detail

Label
Label
Change in CRT gene sequence of Plasmodium falsiparum as a chloroquen resistant in Iraqi patients

Author: ABDULRAZZAQ ZGHAIR, NAZAR SH. MOHAMMED, SALWA S. MUHSIN
Abstract: This study was conducted on (20) individuals whose ages ranged between (9-15) years and suspected to be infected with malaria in Qanaqin and Al-Saadiya towns / Diala province in Iraq during the period from1st June 2018 to 15th may 2019. The results showed that 9 (45%) of them were positive for plasmodium falciparum by using ELISA and IFAT techniques. Conventional PCR was used to determine the genotypes of the parasite. The primers used included forward primer ACTCTGTAGTTTGTAGAGATGCAA and reverse primer ACGGCACATTATCTCACCGTT, in the product of 504 length. Mutations occurred in Iraqi patients infected with chloroquine resistance (CRT) P. falciparum genes. The AAA changed to ATA and AAA to ACA respectively.
Keyword: Plasmodium falsiparum, CRT gene, chloroquine-resistant
DOI: https://doi.org/10.31838/ijpr/2020.12.02.0069
Download: Request For Article
 












ONLINE SUBMISSION
USER LOGIN


Username
Password
Login | Register
News & Events

Terms and Conditions
Disclaimer
Refund Policy
Instrucations for Subscribers
Privacy Policy

Copyrights Form

0.12
2018CiteScore
 
8th percentile
Powered by  Scopus
Google Scholar

hit counters free